Phorinia breviata Tachi & Shima |
ADipBOL is a DNA barcode database of Asian ants. DNA barcoding is a taxonomic method that uses a short genetic marker in an organism's DNA to identify it as belonging to a particular species. The cytochrome c oxidase subunit 1 mitochondrial region (COI) is emerging as the standard barcode region for higher animals. It is 648 nucleotide base pairs long in most groups-a very short sequence. The data of ADipBOL contain standard DNA barcode region and other ones. In insects DNA barcode data of butterflies, mosquitoes and bees have been accumulated. We will accumulate Asian ant DNA barcode data and continue to open to the public.
The total number of specimens in ADipBOL at present is 57 (February 16, 2015). Each record consists of 40 items in the format of the Darwin Core of the Global Biodiversity Information Facility (GBIF), including scientific name, country, collection locality, collection date, collector, etc. of the specimen as well as its barcode data.
The ADipBOL is managed by a text database management system SIGMA.
The ADipBOL file is supported by a Grant-in-Aid for Publication of Scientific Research Results (Head Investigator: Osamu Tadauchi) from the Japan Society for the Promotion of Science.
The use of data in this database is free of charge if the objective is academic study or educational purposes.
1. | (DATE) | Date Last Modified |
2. | (SID) | DNA Sample ID |
3. | (ADipBOLID) | ADipBOL ID |
4. | (GenBank) | GenBank Accesssion No. |
5. | (BOLD) | BOLD ID |
6. | (GEN) | Genome |
7. | (LOCUS) | Locus |
8. | (PCR) | PCR Primers |
9. | (SEQ) | Sequence |
10. | (IST) | Institution Code |
11. | (COLC) | Collection Code |
12. | (NAME) | Scientific name |
13. | (JPNAME) | Japanese name |
14. | (BR) | Basis of Record |
15. | (KING) | Kingdum |
16. | (PHY) | Phylum |
17. | (CL) | Class |
18. | (OR) | Order |
19. | (FAM) | Family |
20. | (GEN) | Genus |
21. | (SP) | Species |
22. | (SSP) | Subspecies |
23. | (AU) | Scientific Name Author |
24. | (IDENT) | Identification By |
25. | (YIDENT) | Year Identified |
26. | (TYPES) | Type Status |
27. | (COL) | Collector |
28. | (COLD) | Collecting Date |
29. | (C) | Country |
30. | (STATE) | State Province |
31. | (COUNT) | County |
32. | (LOC) | Locality |
33. | (LON) | Longitude |
34. | (LAT) | Latitude |
35. | (SEX) | Sex |
36. | (TYPE) | Preparation Type |
37. | (RCAT) | Related Catalog Item |
38. | (SDEP) | Specimen Depository |
39. | (PUB) | Publication |
40. | (NOTE) | Notes |
Date Last Modified | |
DNA Sample ID | Bep1 |
ADipBOL ID | |
GenBank Accesssion No. | AB700004 |
BOLD ID | |
Genome | Mitochondrial |
Locus | COI (cytochrome c oxidase subunit I) |
PCR Primers | LepF1/LepR1 |
Sequence | GGAATAATTGGAACTTCACTAAGAATTTTAATTCGAAGAGAATTAGGACACCCTGGTTCTTTAATTGGAAATGACCAAAT TTATAATGTAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGAA ATTGACTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTACTTCCT CCTTCTTTAATAATTTTATTATCAAGTAGAATAGTAGAAAATGGATCTGGAACAGGATGAACAGTTTACCCTCCTTTATC ATCAGTAATTGCTCATGGAGGAGCATCTGTTGATTTAACAATTTTCTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAG GAGCAGTAAATTTTATTACAACAATTATTAATATACGATCAATAAATTTTTCATTAAATTTTATTCCTTTATTTGTTTGA TCAGTAATTATTACAGCTTTGTTACTTTTATTATCTTTACCAGTATTAGCTGGAGCAATTACTATATTATTAACGGATCG AAATTTAAATACATCTTTTTTTGA |
Institution Code | BLKU |
Collection Code | |
Scientific name | Bessa parallela (Meigen) |
Japanese name | |
Basis of Record | |
Kingdum | Animalia |
Phylum | Arthropoda |
Class | Insecta |
Order | Diptera |
Family | Tachindae |
Genus | Bessa |
Species | parallela |
Subspecies | |
Scientific Name Author | (Meigen) |
Identification By | Takuji Tachi |
Year Identified | 2010 |
Type Status | |
Collector | Takuji Tachi |
Collecting Date | 18/07/2005 |
Country | JP(JAPAN) |
State Province | Fukuoka |
County | |
Locality | Fukuoka City, Mt. Sefuri |
Longitude | |
Latitude | |
Sex | F |
Preparation Type | Normal |
Related Catalog Item | |
Specimen Depository | Kyushu University |
Publication | Molecular phylogeny and host use evolution of the genus Exorista Meigen (Diptera: Tachinidae). Molecular Phylogenetics and Evolution, 66: 401-411. |
Notes |
Tadauchi, O., C. Hirosawa, H. Inoue, T. Sugimoto, R. Murao, N. Takahashi, S. Sato, K. Mitai and Y. Hara, 2009. Specimen database AIIC, Asian insect information center database, based on types and normal specimens collected in Asia and the Pacific Area, Part 1. Esakia, (49): 1-5.
Entomology Database Project Group (Head: O. Tadauchi, Editors: T. Tachi, System administrator: H. Inoue, F. Kamitomo) holds the copyright on the entomology database ADipBOL.
Inquiries and Comments about ADipBOL Should be the Following E-mail Address.