ADipBOL DNA Barcode Database
Title image Phorinia breviata Tachi & Shima

Welcome to the ADipBOL DNA Barcode Database of Asian Flies !

Japanese page is here

ADipBOL is a DNA barcode database of Asian ants. DNA barcoding is a taxonomic method that uses a short genetic marker in an organism's DNA to identify it as belonging to a particular species. The cytochrome c oxidase subunit 1 mitochondrial region (COI) is emerging as the standard barcode region for higher animals. It is 648 nucleotide base pairs long in most groups-a very short sequence. The data of ADipBOL contain standard DNA barcode region and other ones. In insects DNA barcode data of butterflies, mosquitoes and bees have been accumulated. We will accumulate Asian ant DNA barcode data and continue to open to the public.

The total number of specimens in ADipBOL at present is 57 (February 16, 2015). Each record consists of 40 items in the format of the Darwin Core of the Global Biodiversity Information Facility (GBIF), including scientific name, country, collection locality, collection date, collector, etc. of the specimen as well as its barcode data.

The ADipBOL is managed by a text database management system SIGMA.

The ADipBOL file is supported by a Grant-in-Aid for Publication of Scientific Research Results (Head Investigator: Osamu Tadauchi) from the Japan Society for the Promotion of Science.

The use of data in this database is free of charge if the objective is academic study or educational purposes.




Items of Data

Data and Tags are the Following 40 items.
1.(DATE)Date Last Modified
2. (SID) DNA Sample ID
3. (ADipBOLID)ADipBOL ID
4. (GenBank) GenBank Accesssion No.
5. (BOLD) BOLD ID
6. (GEN) Genome
7. (LOCUS) Locus
8. (PCR) PCR Primers
9. (SEQ) Sequence
10. (IST) Institution Code
11. (COLC) Collection Code
12. (NAME) Scientific name
13. (JPNAME) Japanese name
14. (BR) Basis of Record
15. (KING) Kingdum
16. (PHY) Phylum
17. (CL) Class
18. (OR) Order
19. (FAM) Family
20. (GEN) Genus
21. (SP) Species
22. (SSP) Subspecies
23. (AU) Scientific Name Author
24. (IDENT) Identification By
25. (YIDENT) Year Identified
26. (TYPES) Type Status
27. (COL) Collector
28. (COLD) Collecting Date
29. (C) Country
30. (STATE) State Province
31. (COUNT) County
32. (LOC) Locality
33. (LON) Longitude
34. (LAT) Latitude
35. (SEX) Sex
36. (TYPE) Preparation Type
37. (RCAT) Related Catalog Item
38. (SDEP) Specimen Depository
39. (PUB) Publication
40. (NOTE) Notes


Example of a record


Date Last Modified  
DNA Sample ID Bep1
ADipBOL ID  
GenBank Accesssion No. AB700004
BOLD ID  
Genome Mitochondrial
Locus COI (cytochrome c oxidase subunit I)
PCR Primers LepF1/LepR1
Sequence GGAATAATTGGAACTTCACTAAGAATTTTAATTCGAAGAGAATTAGGACACCCTGGTTCTTTAATTGGAAATGACCAAAT TTATAATGTAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGAA ATTGACTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTACTTCCT CCTTCTTTAATAATTTTATTATCAAGTAGAATAGTAGAAAATGGATCTGGAACAGGATGAACAGTTTACCCTCCTTTATC ATCAGTAATTGCTCATGGAGGAGCATCTGTTGATTTAACAATTTTCTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAG GAGCAGTAAATTTTATTACAACAATTATTAATATACGATCAATAAATTTTTCATTAAATTTTATTCCTTTATTTGTTTGA TCAGTAATTATTACAGCTTTGTTACTTTTATTATCTTTACCAGTATTAGCTGGAGCAATTACTATATTATTAACGGATCG AAATTTAAATACATCTTTTTTTGA
Institution Code BLKU
Collection Code  
Scientific name Bessa parallela (Meigen)
Japanese name Japanese String
Basis of Record  
Kingdum Animalia
Phylum Arthropoda
Class Insecta
Order Diptera
Family Tachindae
Genus Bessa
Species parallela
Subspecies  
Scientific Name Author (Meigen)
Identification By Takuji Tachi
Year Identified 2010
Type Status  
Collector Takuji Tachi
Collecting Date 18/07/2005
Country JP(JAPAN)
State Province Fukuoka
County  
Locality Fukuoka City, Mt. Sefuri
Longitude  
Latitude  
Sex F
Preparation Type Normal
Related Catalog Item  
Specimen Depository Kyushu University
Publication Molecular phylogeny and host use evolution of the genus Exorista Meigen (Diptera: Tachinidae). Molecular Phylogenetics and Evolution, 66: 401-411.
Notes  


Publications, Manuals and Explanations

  Tadauchi, O., C. Hirosawa, H. Inoue, T. Sugimoto, R. Murao, N. Takahashi, S. Sato, K. Mitai and Y. Hara, 2009. Specimen database AIIC, Asian insect information center database, based on types and normal specimens collected in Asia and the Pacific Area, Part 1. Esakia, (49): 1-5.



Copyright Notice

Entomology Database Project Group (Head: O. Tadauchi, Editors: T. Tachi, System administrator: H. Inoue, F. Kamitomo) holds the copyright on the entomology database ADipBOL.



Inquiries and Comments

Inquiries and Comments about ADipBOL Should be the Following E-mail Address.

Database ADipBOL (Osamu Tadauchi, Satoshi Kamitani)
Entomological Laboratory,
Faculty of Agriculture,
Kyushu University
Fukuoka, 812-8581
Japan
E-mail: tadauchi@kyudai.jp
E-mail: kamitani@agr.kyushu-u.ac.jp


Link