Gronotoma micromorpha (Perkins) |
ACynipoidBOL is a DNA barcode database of Asian Cynipidae. DNA barcoding is a taxonomic method that uses a short genetic marker in an organism's DNA to identify it as belonging to a particular species. The cytochrome c oxidase subunit 1 mitochondrial region (COI) is emerging as the standard barcode region for higher animals. It is 648 nucleotide base pairs long in most groups-a very short sequence. The data of ACynipoidBOL contain standard DNA barcode region and other ones. In insects DNA barcode data of butterflies, mosquitoes and bees have been accumulated. We will accumulate Asian ant DNA barcode data and continue to open to the public.
The total number of specimens in ACynipoidBOL at present is 60 (February 16, 2015). Each record consists of 41 items in the format of the Darwin Core of the Global Biodiversity Information Facility (GBIF), including scientific name, country, collection locality, collection date, collector, etc. of the specimen as well as its barcode data.
The ACynipoidBOL is managed by a text database management system SIGMA.
The ACynipoidBOL file is supported by a Grant-in-Aid for Publication of Scientific Research Results (Head Investigator: Osamu Tadauchi) from the Japan Society for the Promotion of Science.
The use of data in this database is free of charge if the objective is academic study or educational purposes.
1. | (DATE) | Date Last Modified |
2. | (SID) | DNA Sample ID |
3. | (ACynipoidBOLID) | ACynipoidBOL ID |
4. | (GenBank) | GenBank Accesssion No. |
5. | (BOLD) | BOLD ID |
6. | (GEN) | Genome |
7. | (LOCUS) | Locus |
8. | (PCR) | PCR Primers |
9. | (SEQ) | Sequence |
10. | (IST) | Institution Code |
11. | (COLC) | Collection Code |
12. | (NAME) | Scientific name |
13. | (JPNAME) | Japanese name |
14. | (BR) | Basis of Record |
15. | (KING) | Kingdum |
16. | (PHY) | Phylum |
17. | (CL) | Class |
18. | (OR) | Order |
19. | (FAM) | Family |
20. | (GEN) | Genus |
21. | (SP) | Species |
22. | (SSP) | Subspecies |
23. | (AU) | Scientific Name Author |
24. | (IDENT) | Identification By |
25. | (YIDENT) | Year Identified |
26. | (TYPES) | Type Status |
27. | (COL) | Collector |
28. | (COLD) | Collecting Date |
29. | (C) | Country |
30. | (STATE) | State Province |
31. | (COUNT) | County |
32. | (LOC) | Locality |
33. | (LON) | Longitude |
34. | (LAT) | Latitude |
35. | (SEX) | Sex |
36. | (TYPE) | Preparation Type |
37. | (RCAT) | Related Catalog Item |
38. | (SDEP) | Specimen Depository |
39. | (PUB) | Publication |
40. | (NOTE) | Notes |
41. | (IMAGE) | Image |
Date Last Modified | 2014 2. 18 |
DNA Sample ID | Dkuri1 |
ACynipoidBOL ID | ACynipoidBOL No.1 |
GenBank Accesssion No. | |
BOLD ID | |
Genome | Mitochondrial |
Locus | COI (cytochrome c oxidase subunit I) |
PCR Primers | LCO1490/HCO2198 |
Sequence | AATATTATATTTTTTATTTGGAATTTGATCGGGGATAATTGGATCAAGATTAAGAATAATTATTCGAATAGAATTAGGGA CCCCTTTACAATTGATTAGAAATGATCAATTATATAATTCTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATG GTTATACCCATTATAGTAGGAGGGTTTGGTAATTATTTAATTCCATTAATATTAGTTTCTCCAGATATAGCTTTCCCTCG TTTAAATAATATAAGATATTGATTATTAATCCCTGCATTATTATTAATAATATCAAGAATATTTATTGATCAGGGAGCAG GAACAGGATGAACTGTTTACCCTCCTTTGTCTTCTAATATAGGACATTCGGGGGTTTCAGTTGATTTAACTATTTATTCT TTACATTTAAGTGGTATTTCTTCAATTTTAGGGTCTATTAATTTTATTACAACTATTTTAAATATACGACCTTATTTAAT ATCAATAGATAAAATTCCTTTATTTGTTTGATCAATTTTTTTAACTACAATTTTATTACTTTTATCCTTACCTGTTTTAG CGGGGGCTATTACTATATTGTTATTTGATCGTAATATAAATACTTCTTTTTTTGACCCAATAGGAGGAGGAGATCCTATT TTATACCAACATTTATTT |
Institution Code | BLKU |
Collection Code | ACynipoidBOL |
Scientific name | Dryocosmus kuriphilus |
Japanese name | |
Basis of Record | |
Kingdum | Animalia |
Phylum | Arthropoda |
Class | Insecta |
Order | Hymenoptera |
Family | Cynipidae |
Genus | Dryocosmus |
Species | kuriphilus |
Subspecies | |
Scientific Name Author | Yasumatsu, 1951 |
Identification By | Tatsuya Ide |
Year Identified | 2012 |
Type Status | |
Collector | Tatsuya Ide |
Collecting Date | 23/06/2012 |
Country | JP(JAPAN) |
State Province | Fukuoka |
County | |
Locality | Shiibaru, Sawara-ku, Fukuoka Pref. |
Longitude | |
Latitude | |
Sex | F |
Preparation Type | Normal |
Related Catalog Item | |
Specimen Depository | Kyushu University |
Publication | |
Notes | host: Castanea crenata; em. 09/07/2011, from bud gall, Fukuoka-shi |
Image |
Tadauchi, O., C. Hirosawa, H. Inoue, T. Sugimoto, R. Murao, N. Takahashi, S. Sato, K. Mitai and Y. Hara, 2009. Specimen database AIIC, Asian insect information center database, based on types and normal specimens collected in Asia and the Pacific Area, Part 1. Esakia, (49): 1-5.
Entomology Database Project Group (Head: O. Tadauchi, Editors: Y. Abe, T. Ide, System administrator: H. Inoue, F. Kamitomo) holds the copyright on the entomology database ACynipoidBOL.
Inquiries and Comments about ACynipoidBOL Should be the Following E-mail Address.