|
Voucher specimen of Andrena yamato Tadauchi et Hirashima |
ABeeBOL is a DNA barcode database of Asian bees. DNA barcoding is a taxonomic method that uses a short genetic marker in an organism's DNA to identify it as belonging to a particular species. The cytochrome c oxidase subunit 1 mitochondrial region (COI) is emerging as the standard barcode region for higher animals. It is 648 nucleotide base pairs long in most groups-a very short sequence. The data of ABeeBOL contain standard DNA barcode region and other ones. In insects DNA barcode data of butterflies and mosquitoes have been accumulated. Those of bees also have been rapidly accumulated after BEEBOL, a committee promoting DNA barcoding of bees was organized by Professor Laurence Packer of York University, Canada in 2008. We will continue to accumulate Asian bee DNA barcode data.
The total number of specimens in ABeeBOL at present is 252 (January 9, 2015). Each record consists of 41 items in the format of the Darwin Core of the Global Biodiversity Information Facility (GBIF), including scientific name, country, collection locality, collection date, collector, etc. of the specimen as well as its barcode data.
The ABeeBOL is managed by a text database management system SIGMA.
The ABeeBOL file is supported by a Grant-in-Aid for Publication of Scientific Research Results (Head Investigator: Osamu Tadauchi) from the Japan Society for the Promotion of Science and by the Environment Research and Technology Development Fund (S-9-2(8)) of the Ministry of the Environment, Japan (Head Investigator: Osamu Tadauchi).
The use of data in this database is free of charge if the objective is academic study or educational purposes.
| 1. | (DATE) | Date Last Modified |
| 2. | (SID) | DNA Sample ID |
| 3. | (ABeeBOLID) | ABeeBOL ID |
| 4. | (GenBank) | GenBank Accesssion No. |
| 5. | (BOLD) | BOLD ID |
| 6. | (GEN) | Genome |
| 7. | (LOCUS) | Locus |
| 8. | (PCR) | PCR Primers |
| 9. | (SEQ) | Sequence |
| 10. | (IST) | Institution Code |
| 11. | (COLC) | Collection Code |
| 12. | (NAME) | Scientific name |
| 13. | (JPNAME) | Japanese name |
| 14. | (BR) | Basis of Record |
| 15. | (KING) | Kingdum |
| 16. | (PHY) | Phylum |
| 17. | (CL) | Class |
| 18. | (OR) | Order |
| 19. | (FAM) | Family |
| 20. | (GEN) | Genus |
| 21. | (SP) | Species |
| 22. | (SSP) | Subspecies |
| 23. | (AU) | Scientific Name Author |
| 24. | (IDENT) | Identification By |
| 25. | (YIDENT) | Year Identified |
| 26. | (TYPES) | Type Status |
| 27. | (COL) | Collector |
| 28. | (COLD) | Collecting Date |
| 29. | (C) | Country |
| 30. | (STATE) | State Province |
| 31. | (COUNT) | County |
| 32. | (LOC) | Locality |
| 33. | (LON) | Longitude |
| 34. | (LAT) | Latitude |
| 35. | (SEX) | Sex |
| 36. | (TYPE) | Preparation Type |
| 37. | (RCAT) | Related Catalog Item |
| 38. | (SDEP) | Specimen Depository |
| 39. | (PUB) | Publication |
| 40. | (NOTE) | Notes |
| 41. | (IMAGE) | Image |
| Date Last Modified | 2013 12. 17 |
| DNA Sample ID | DNA000130 |
| ABeeBOL ID | ABeeBOL No.27 |
| GenBank Accesssion No. | |
| BOLD ID | |
| Genome | Mitochondrial |
| Locus | COI (cytochrome c oxidase subunit I) |
| PCR Primers | COI_pF2/COI_2437d |
| Sequence | ATGATTAGTTCCACTAATAATTGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGATTCTGACTCCTT-ATT CCTTCCCTATTTATATTATTAATAAGAAGAATTCTAGCCTCTGGATCAGGAACAGGATGAACAGTATACCCCCCACTTTC TTCAATTATATACCATTCATCAATCTCAGTAGATTGCACAATTTTTTCATTACATATCGCAGGAATTTCATCAATTATAG GAGCTATTAATTTTATTGTTTCAATTATATTAATAAAAAATATTTCAATTAATTATGATCAAATTCCACTATTTCCATGA TCAGTAAAAATTACTGCTATTCTATTACTATTATCTTTACCAGTACTAGCAGGAGCTATTACAATACTATTAACTGATCG AAATTTAAATACCTCATTTTTCGACCCCTCAGGAGGAGGAGACCCTATTCTTTATCAACATCTATTTTGATTCTTTGGTC ACCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGATTAATTTCACATATCATTTTTAATGAAAGAGGTAAAAAGGAA ATCTTTGGTAATTTAGGTATAATTTATGCTATACTAGGAATTGGATTTTTAGGATTCATTGTTTGAGCCCATCACATATT CACAGTAGGTCTAGACGTTGATACACGAGCATATTTTACATCTGCAACAATAATTATTGCAGTACCTA |
| Institution Code | ELKU |
| Collection Code | ABeeBOL |
| Scientific name | Lasioglossum (Evylaeus) metis |
| Japanese name |  |
| Basis of Record |  |
| Kingdum | Animalia |
| Phylum | Arthropoda |
| Class | Insecta |
| Order | Hymenoptera |
| Family | Halictidae |
| Genus | Lasioglossum |
| Species | metis |
| Subspecies | |
| Scientific Name Author | Ebmer, 2002 |
| Identification By | Ryuki Murao |
| Year Identified | 2013 |
| Type Status | |
| Collector | Ryuki Murao |
| Collecting Date | 13/06/2013 |
| Country | JP(JAPAN) |
| State Province | Fukuoka |
| County | Tagawa-gun |
| Locality | Kyushu Univ., Hikosan Exp. Sta., Soeda-machi |
| Longitude | 130.9154033 |
| Latitude | 33.48020722 |
| Sex | F |
| Preparation Type | Normal |
| Related Catalog Item | |
| Specimen Depository | Kyushu University |
| Publication | |
| Notes | |
| Image |  |
Tadauchi, O., C. Hirosawa, H. Inoue, T. Sugimoto, R. Murao, N. Takahashi, S. Sato, K. Mitai and Y. Hara, 2009. Specimen database AIIC, Asian insect information center database, based on types and normal specimens collected in Asia and the Pacific Area, Part 1. Esakia, (49): 1-5.
Entomology Database Project Group (Head: O. Tadauchi, Editors: O. Tadauchi, R. Murao, M. Maruyama, System administrator: H. Inoue, F. Kamitomo) holds the copyright on the entomology database ABeeBOL.
When a user uses the data on the ABeeBOL and publishes the study, the recommended citation is as follows:
Murao, R. and O. Tadauchi (2013-) Entomology Database, ABeeBOL, http://konchudb.agr.agr.kyushu-u.ac.jp/abeebol/index-e.html (December 19, 2013).
Inquiries and Comments about ABeeBOL Should be the Following E-mail Address.